fourfinger
Single Origami Analysis
11 March 2024 10:45:04
Origami Info
Scaffold
| Scaffold Length (nt) |
Scaffold Type |
Scaffold Bases Paired with Staples in Design |
Scaffold Bases Left Single Stranded in Design |
| 704 |
LINEAR |
704 |
0 |
Staples
| Staple Count |
Staple Min Length (nt) |
Staple Max Length (nt) |
Staple Mean Length (nt) |
| 24 |
18 |
42 |
29.33 |
Special Staples with Single Stranded Regions
| Staples with Dangles |
Staples with Interior Loopouts |
Staple Bases Left Single Stranded in Design |
| 0 |
0 |
0 |
Staple Splits
| Total Staple Sections Binding Scaffold in Design |
Number of Staples with 1/2/3/3+ Sections |
Max Sections on a Staple |
| 56 |
2/13/8/1 |
4 |
| Staple Section Size (nt) |
Number |
Percent Fraction of All 56 Staple Sections |
| 6 |
1 |
1.79 |
| 8 |
11 |
19.64 |
| 9 |
4 |
7.14 |
| 10 |
2 |
3.57 |
| 11 |
13 |
23.21 |
| 12 |
5 |
8.93 |
| 13 |
2 |
3.57 |
| 15 |
2 |
3.57 |
| 16 |
7 |
12.50 |
| 17 |
1 |
1.79 |
| 18 |
1 |
1.79 |
| 19 |
2 |
3.57 |
| 20 |
1 |
1.79 |
| 21 |
3 |
5.36 |
| 27 |
1 |
1.79 |
Metric Scores
| G Quad Staples |
Metric 1 |
Metric 2 |
Metric 3 |
Metric 4 |
Origami Contact Map |
Origami Sequences |
Scaffold Primers |
| 2 |
233.27 |
130.96 |
11.02 |
1.06 |
CSV |
FASTA |
FASTA |
Metric Energy Distributions
Metric 1 (Staples-Scaffold) Energy Distribution
| Units: kcal/mol (at 37C) |
Mean |
Standard Dev. |
Min |
Max |
Sum Total |
Min dG Detectable |
Histogram Raw Data |
| Metric 1 On-target Binding Site Energies |
-15.30 |
5.79 |
-35.06 |
-8.86 |
-841.48 |
-7 |
CSV |
| Metric 1 Off-target Binding Site Energies |
-8.27 |
1.40 |
-13.29 |
-7.55 |
-223.36 |
-7 |
CSV |
| Total of Metric 1 Binding Site Energies (Total1) |
|
|
|
|
-1064.84 |
|
|
| Total Energy of Designed Staple Binding Sites (Total2) |
|
|
|
|
-831.58 |
|
|
| (Approx) Metric 1 Score: Total1 - Total2 |
|
|
|
|
-233.27 |
|
|
Metric 1 Visualisation
| Plot Colour |
Meaning |
|
Designed staple binding site in original origami design |
| Background |
Overall scaffold coverage of designed staple binding sites in origami design |
|
On-target staple binding site identified by energy model (i.e. one that covers a designed binding site) |
|
Off-target staple binding site identified by energy model |
|
Top 10 highest energy off-target staple binding sites [ Download as TXT File ] |
Metric 2 (Scaffold-Scaffold) Energy Distribution
| Units: kcal/mol (at 37C) |
Mean |
Standard Dev. |
Min |
Max |
Sum Total |
Min dG Detectable |
Histogram Raw Data |
Binding Sites File |
| Metric 2 Binding Site Energies |
-8.19 |
1.30 |
-12.93 |
-7.55 |
-130.96 |
-7 |
CSV |
TXT |
Metric 3 (Staples-Staples) Energy Distribution
| Units: kcal/mol (at 55C) |
Mean |
Standard Dev. |
Min |
Max |
Sum Total |
Histogram Raw Data |
| Metric 3 Binding Site Energies |
-4.02 |
1.29 |
-11.02 |
-1.57 |
-1206.95 |
CSV |
| |
Worst Staple-Staple Co-fold |
| Staple IDs |
11 + 11 |
| Staple Sequences 5'-3' |
GTGCTGCAGCAACTGTTGGGAAGG+GTGCTGCAGCAACTGTTGGGAAGG |
| Before Reaction Dotparens |
........................|........................ |
| After Reaction Dotparens |
.((((((((((.............+.))))))))))............. |
| Nett Free Energy of Binding (at 55C) |
-11.02 kcal/mol |
Metric 4 (Intra-Staple) Energy Distribution
| Units: kcal/mol (at 55C) |
Mean |
Standard Dev. |
Min |
Max |
Sum Total |
Histogram Raw Data |
| Metric 4 Binding Site Energies |
-0.12 |
0.30 |
-1.06 |
0 |
-2.86 |
CSV |
| |
Worst Single Staple Hairpin |
| Staple ID |
20 |
| Staple Sequence 5'-3' |
CTTGCATGCCTCAGGTCATTGCCTGAGAGT |
| Secondary Structure Dotparens |
.........((((((......))))))... |
| Secondary Structure Energy (at 55C) |
-1.06 kcal/mol |