fourfinger

Single Origami Analysis
11 March 2024 10:45:04

Origami Info

Scaffold

Scaffold Length (nt) Scaffold Type Scaffold Bases Paired with Staples in Design Scaffold Bases Left Single Stranded in Design
704 LINEAR 704 0

Staples

Staple Count Staple Min Length (nt) Staple Max Length (nt) Staple Mean Length (nt)
24 18 42 29.33

Special Staples with Single Stranded Regions

Staples with Dangles Staples with Interior Loopouts Staple Bases Left Single Stranded in Design
0 0 0

Staple Splits

Total Staple Sections Binding Scaffold in Design Number of Staples with 1/2/3/3+ Sections Max Sections on a Staple
56 2/13/8/1 4
Staple Section Size (nt) Number Percent Fraction of All 56 Staple Sections
6 1 1.79
8 11 19.64
9 4 7.14
10 2 3.57
11 13 23.21
12 5 8.93
13 2 3.57
15 2 3.57
16 7 12.50
17 1 1.79
18 1 1.79
19 2 3.57
20 1 1.79
21 3 5.36
27 1 1.79

Metric Scores

G Quad Staples Metric 1 Metric 2 Metric 3 Metric 4 Origami Contact Map Origami Sequences Scaffold Primers
2 233.27 130.96 11.02 1.06 CSV FASTA FASTA

Metric Energy Distributions

Metric 1 (Staples-Scaffold) Energy Distribution

Units: kcal/mol (at 37C) Mean Standard Dev. Min Max Sum Total Min dG Detectable Histogram Raw Data
Metric 1 On-target Binding Site Energies -15.30 5.79 -35.06 -8.86 -841.48 -7 CSV
Metric 1 Off-target Binding Site Energies -8.27 1.40 -13.29 -7.55 -223.36 -7 CSV
Total of Metric 1 Binding Site Energies (Total1) -1064.84
Total Energy of Designed Staple Binding Sites (Total2) -831.58
(Approx) Metric 1 Score: Total1 - Total2 -233.27

Metric 1 Visualisation

Plot Colour Meaning
Designed staple binding site in original origami design
Background Overall scaffold coverage of designed staple binding sites in origami design
On-target staple binding site identified by energy model (i.e. one that covers a designed binding site)
Off-target staple binding site identified by energy model
Top 10 highest energy off-target staple binding sites [ Download as TXT File ]

Metric 2 (Scaffold-Scaffold) Energy Distribution

Units: kcal/mol (at 37C) Mean Standard Dev. Min Max Sum Total Min dG Detectable Histogram Raw Data Binding Sites File
Metric 2 Binding Site Energies -8.19 1.30 -12.93 -7.55 -130.96 -7 CSV TXT

Metric 3 (Staples-Staples) Energy Distribution

Units: kcal/mol (at 55C) Mean Standard Dev. Min Max Sum Total Histogram Raw Data
Metric 3 Binding Site Energies -4.02 1.29 -11.02 -1.57 -1206.95 CSV
  Worst Staple-Staple Co-fold
Staple IDs 11 + 11
Staple Sequences 5'-3' GTGCTGCAGCAACTGTTGGGAAGG+GTGCTGCAGCAACTGTTGGGAAGG
Before Reaction Dotparens ........................|........................
After Reaction Dotparens .((((((((((.............+.)))))))))).............
Nett Free Energy of Binding (at 55C) -11.02 kcal/mol

Metric 4 (Intra-Staple) Energy Distribution

Units: kcal/mol (at 55C) Mean Standard Dev. Min Max Sum Total Histogram Raw Data
Metric 4 Binding Site Energies -0.12 0.30 -1.06 0 -2.86 CSV
  Worst Single Staple Hairpin
Staple ID 20
Staple Sequence 5'-3' CTTGCATGCCTCAGGTCATTGCCTGAGAGT
Secondary Structure Dotparens .........((((((......))))))...
Secondary Structure Energy (at 55C) -1.06 kcal/mol